* using log directory 'd:/Rcompile/CRANpkg/local/3.5/metacoder.Rcheck' * using R version 3.5.3 (2019-03-11) * using platform: x86_64-w64-mingw32 (64-bit) * using session charset: ISO8859-1 * checking for file 'metacoder/DESCRIPTION' ... OK * this is package 'metacoder' version '0.3.3' * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking whether package 'metacoder' can be installed ... OK * checking installed package size ... OK * checking package directory ... OK * checking 'build' directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking R files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * loading checks for arch 'i386' ** checking whether the package can be loaded ... OK ** checking whether the package can be loaded with stated dependencies ... OK ** checking whether the package can be unloaded cleanly ... OK ** checking whether the namespace can be loaded with stated dependencies ... OK ** checking whether the namespace can be unloaded cleanly ... OK ** checking loading without being on the library search path ... OK ** checking use of S3 registration ... OK * loading checks for arch 'x64' ** checking whether the package can be loaded ... OK ** checking whether the package can be loaded with stated dependencies ... OK ** checking whether the package can be unloaded cleanly ... OK ** checking whether the namespace can be loaded with stated dependencies ... OK ** checking whether the namespace can be unloaded cleanly ... OK ** checking loading without being on the library search path ... OK ** checking use of S3 registration ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... [12s] OK * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of 'data' directory ... OK * checking data for non-ASCII characters ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking pragmas in C/C++ headers and code ... OK * checking compiled code ... OK * checking installed files from 'inst/doc' ... OK * checking files in 'vignettes' ... OK * checking examples ... ** running examples for arch 'i386' ... [2s] OK ** running examples for arch 'x64' ... [2s] OK * checking for unstated dependencies in 'tests' ... OK * checking tests ... ** running tests for arch 'i386' ... [124s] ERROR Running 'testthat.R' [123s] Running the tests in 'tests/testthat.R' failed. Complete output: > library(testthat) > > suppressPackageStartupMessages(library(metacoder)) > > test_check("metacoder") -- 1. Failure: Summing counts per taxon (@test--calculations.R#103) ----------- sum(x$data$tax_data$`700035949`) not equal to result$`700035949`[1]. names for current but not for target -- 2. Failure: Summing counts per taxon (@test--calculations.R#126) ----------- `total_counts` not equal to result$total[1]. names for current but not for target -- 3. Failure: Parsing the UNITE general release fasta (@test--parsers_and_write result$data$tax_data$unite_seq[5] not equal to "CCAAATCATGTCTCCCGGCCGCAAGGCAGGTGCAGGCGTTTAACCCTTTGTGAACCAAAAAACCTTTCGCTTCGGCAGCAGCTCGGTTGGAGACAGCCTCTGTGTCAGCCTGCCGCTAGCACCAATTATCAAAACTTGCGGTTAGCAACATTGTCTGATTACCAAATTTTCGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCATTGGTATTCCATTGGGCATGTCTGTTTGAGCGTCATTACAACCCTCGGTCACCACCGGTTTTGAGCGAGCAGGGTCTTCGGATCCAGCTGGCTTTAAAGTTGTAAGCTCTGCTGGCTGCTCGGCCCAACCAGAACATAGTAAAATCATGCTTGTTCAAGGTTCGCGGTCGAAGCGGTACGGCCTGAACAATACCTACCACCTCTTAGG". names for target but not for current == testthat results =========================================================== [ OK: 93 | SKIPPED: 1 | WARNINGS: 1 | FAILED: 3 ] 1. Failure: Summing counts per taxon (@test--calculations.R#103) 2. Failure: Summing counts per taxon (@test--calculations.R#126) 3. Failure: Parsing the UNITE general release fasta (@test--parsers_and_writers.R#119) Error: testthat unit tests failed Execution halted ** running tests for arch 'x64' ... [142s] ERROR Running 'testthat.R' [141s] Running the tests in 'tests/testthat.R' failed. Complete output: > library(testthat) > > suppressPackageStartupMessages(library(metacoder)) > > test_check("metacoder") -- 1. Failure: Summing counts per taxon (@test--calculations.R#103) ----------- sum(x$data$tax_data$`700035949`) not equal to result$`700035949`[1]. names for current but not for target -- 2. Failure: Summing counts per taxon (@test--calculations.R#126) ----------- `total_counts` not equal to result$total[1]. names for current but not for target -- 3. Failure: Parsing the UNITE general release fasta (@test--parsers_and_write result$data$tax_data$unite_seq[5] not equal to "CCAAATCATGTCTCCCGGCCGCAAGGCAGGTGCAGGCGTTTAACCCTTTGTGAACCAAAAAACCTTTCGCTTCGGCAGCAGCTCGGTTGGAGACAGCCTCTGTGTCAGCCTGCCGCTAGCACCAATTATCAAAACTTGCGGTTAGCAACATTGTCTGATTACCAAATTTTCGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCATTGGTATTCCATTGGGCATGTCTGTTTGAGCGTCATTACAACCCTCGGTCACCACCGGTTTTGAGCGAGCAGGGTCTTCGGATCCAGCTGGCTTTAAAGTTGTAAGCTCTGCTGGCTGCTCGGCCCAACCAGAACATAGTAAAATCATGCTTGTTCAAGGTTCGCGGTCGAAGCGGTACGGCCTGAACAATACCTACCACCTCTTAGG". names for target but not for current == testthat results =========================================================== [ OK: 93 | SKIPPED: 1 | WARNINGS: 1 | FAILED: 3 ] 1. Failure: Summing counts per taxon (@test--calculations.R#103) 2. Failure: Summing counts per taxon (@test--calculations.R#126) 3. Failure: Parsing the UNITE general release fasta (@test--parsers_and_writers.R#119) Error: testthat unit tests failed Execution halted * checking for unstated dependencies in vignettes ... OK * checking package vignettes in 'inst/doc' ... OK * checking re-building of vignette outputs ... [1s] OK * checking PDF version of manual ... OK * DONE Status: 2 ERRORs